View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-L2_18 (Length: 204)
Name: R108-L2_18
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R108-L2_18 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 37817768 - 37817968
Alignment:
| Q |
1 |
ttttatggggaagcaggtaatgagagaggagacttaatttgttaacatgacacaaaggttgttttgagatattttactgatgtttttgttgatatcatgt |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37817768 |
ttttatggggaagaaggtaatgagagaggagacttaatttgttaacatgacacaaaggttgttttgagttattttactgatgtttttgttgatatcatgt |
37817867 |
T |
|
| Q |
101 |
aataggaatgaaatannattatgatttataagcnaagctctaccctctgtgttctttatcaaagtattannnnnnngcaagtgtgatctttataattata |
200 |
Q |
| |
|
||||||||||||||| ||||||| |||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37817868 |
aataggaatgaaata-gattatga-ttataagcaaagctctaccctctgtgttc-ttatcaaagtattatttttttgcaagtgtgatctttataattata |
37817964 |
T |
|
| Q |
201 |
tatt |
204 |
Q |
| |
|
|||| |
|
|
| T |
37817965 |
tatt |
37817968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9689 times since January 2019
Visitors: 7932