View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-L3_1 (Length: 66)
Name: R108-L3_1
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] R108-L3_1 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 56; Significance: 5e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 5e-24
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 33630958 - 33630903
Alignment:
Q |
1 |
catcacccttaaatcaaatatttcatttagtagcggtaaatacatcaattaatatt |
56 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33630958 |
catcacccttaaatcaaatatttcatttagtagcggtaaatacatcaattaatatt |
33630903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8492 times since January 2019
Visitors: 7803