View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-L4_39 (Length: 473)
Name: R108-L4_39
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R108-L4_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 332979 - 333225
Alignment:
| Q |
1 |
cttttgtatcatacacaacatgatatgattccaacgttgggaactttgattggatttgctcaatccatgtcttgtcttcttcaaggaaaacggtccggcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
332979 |
cttttgtatcatacacaacatgatatgattccaacgttgggaactttgattggatttgctcaatccatgtcttgtcttcttcaaggaaaacggtccggcc |
333078 |
T |
|
| Q |
101 |
gccgtagtttaatgatgtccacatgagactatcatgacctaatccaaagaccaagaagttgcaaggtgannnnnnnngaagaactttggctgagactgag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
333079 |
gccgtagtttaatgatgtccacatgagactatcatgacctaatccaaagaccaagaagttgcaaggtgattttttttgaagaactttggctgagactgag |
333178 |
T |
|
| Q |
201 |
atctcttgaattgtttgttgaggggtgatttttgttgntgcntaatg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
333179 |
atctcttgaattgtttgttgaggggtgatttttgttgttgcataatg |
333225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13159 times since January 2019
Visitors: 8270