View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-L4_5 (Length: 122)
Name: R108-L4_5
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] R108-L4_5 |
| |
|
[»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 3e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 3e-36
Query Start/End: Original strand, 26 - 122
Target Start/End: Complemental strand, 34668341 - 34668245
Alignment:
Q |
26 |
tacaattgtctacaaatcagaattgtacatcaatataaactgctaaaagttatgaacaagaaagataatcaaataatcatacttaatgtggtatcag |
122 |
Q |
|
|
||||||||||||||||||| |||||||||||||||| || |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34668341 |
tacaattgtctacaaatcaaaattgtacatcaatattaattgctaacagttttgaacaagaaagataatcaaataatcatacttaatgtggtatcag |
34668245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9212 times since January 2019
Visitors: 7893