View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-L5_29 (Length: 233)
Name: R108-L5_29
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R108-L5_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 65 - 124
Target Start/End: Original strand, 28287335 - 28287394
Alignment:
| Q |
65 |
aatttgcctacttacncaatctaacattgattcaatataacgggagaattgagagggaga |
124 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28287335 |
aatttgcctacttactcaatttaacattgattcaatataacgggagaattgagagggaga |
28287394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 8 - 62
Target Start/End: Original strand, 28287485 - 28287539
Alignment:
| Q |
8 |
tatggtattgtcgtaaaagaaaatttaagaagcaaggtactcacaactagaatga |
62 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28287485 |
tatgatattgtcgtaaaagaaaatttaagaagcaaggtactcacaactagaatga |
28287539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12866 times since January 2019
Visitors: 8269