View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-L5_84 (Length: 201)
Name: R108-L5_84
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R108-L5_84 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 38666230 - 38666030
Alignment:
| Q |
1 |
taacataagtgctataccacgtatatcgtcaccaaattgatccttgtgaaatatcaccaacctaatattttggctaaagatcctaactgatcattgtgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
38666230 |
taacataagtgctataccacgtatatcgtcaccaaattgatccttgtgaaatatcaccaacctaatattttggctaaagatcctaactgatcattgttaa |
38666131 |
T |
|
| Q |
101 |
acaaatttacaacttccttataccataagactaattaaagattcaaattaatccttgtgaaaaatcacaaacaacctatttggtctttgagaattaaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38666130 |
acaaatttacaacttccttataccataagactaattaaagattcaaattaatccttgtgaaaaatcacaaacaacctatttggtctttgagaattaaatt |
38666031 |
T |
|
| Q |
201 |
a |
201 |
Q |
| |
|
| |
|
|
| T |
38666030 |
a |
38666030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11511 times since January 2019
Visitors: 8091