View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk148-1 (Length: 220)
Name: R108-tnk148-1
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R108-tnk148-1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 46696114 - 46695923
Alignment:
| Q |
1 |
actacacgaggtacttgtaaaatctttttcctagtttatgttgtttatgattttgaattacgataattgatcgatgtttctgataactctattattcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46696114 |
actacacgaggtacttgtaaaatctttttcctagtttatgttgtttatgattttgaattacgataattgatcgatgtttctgataactctattattcatt |
46696015 |
T |
|
| Q |
101 |
gctaggaataaccttttggacaaatcaatgcataaagtttcatctgggaatgtaaataaaatatattcacatgaagaagctcttaagaattc |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46696014 |
gctaggaataaccttttggacaaatcaatgcataaagtttcatctgggaatgtaaataaaatatattcacatgaagaagctcttaagaattc |
46695923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 220
Target Start/End: Complemental strand, 46696143 - 46696110
Alignment:
| Q |
187 |
gaattcacctgacccgatctatttaaaggactac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
46696143 |
gaattcacctgacccgatctatttaaaggactac |
46696110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9183 times since January 2019
Visitors: 7893