View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk148-26 (Length: 105)
Name: R108-tnk148-26
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] R108-tnk148-26 |
| |
|
[»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 8e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 8e-40
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 31389175 - 31389089
Alignment:
Q |
19 |
ccaattatacccatcatcatgattcacccttctcaaagaatgactttgttggctaacattcctatgatcagattgaaattcatttat |
105 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
31389175 |
ccaattatacccatcatcatgattcacccttctcaaagaatgactttgttggctaacattcctatgatgagattgaaattcatttat |
31389089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 19 - 103
Target Start/End: Complemental strand, 31496455 - 31496368
Alignment:
Q |
19 |
ccaattatacccatcatcatgattcacccttctca---aagaatgactttgttggctaacattcctatgatcagattgaaattcattt |
103 |
Q |
|
|
|||||||||||||||||||||||||| |||||| | | || | | ||||||||| | |||| |||| ||||||||||||||||||| |
|
|
T |
31496455 |
ccaattatacccatcatcatgattcatccttcttactgacgacttattttgttggcgaccattactataatcagattgaaattcattt |
31496368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12552 times since January 2019
Visitors: 8222