View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk148-51 (Length: 128)
Name: R108-tnk148-51
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R108-tnk148-51 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 3e-49; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 3e-49
Query Start/End: Original strand, 3 - 128
Target Start/End: Complemental strand, 42786661 - 42786533
Alignment:
| Q |
3 |
attcacgcacgggttcctttaccagggcaggacctcaatggacgacaaaattctcgatcaagagttttgtagttgctgcat---ttatattgctggattt |
99 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
42786661 |
attcacgcacgggttccttgaccagggcaggacctcaatggacgacaaaattctcgatcaagagttttgtagttgttgcatttattatattgctggattc |
42786562 |
T |
|
| Q |
100 |
gaactcaacacatcaagtgaaattagaaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
42786561 |
aaactcaacacatcaagtgaaattagaaa |
42786533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11251 times since January 2019
Visitors: 8059