View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk176-7 (Length: 299)
Name: R108-tnk176-7
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R108-tnk176-7 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 54 - 299
Target Start/End: Original strand, 45565436 - 45565669
Alignment:
| Q |
54 |
tgtttgcttctttcggactgtttcccactgatataaagcttcaggtgcacgctggacagcacctgtggcagcacctgcgcctctgctaactgaatcccac |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45565436 |
tgtttgcttctttcggactgtttcccactgatataaagcttcaggtgcacgctggacagc------------acctgcgcctctgctaactgaatcccac |
45565523 |
T |
|
| Q |
154 |
agatcagcctcgcaccatatttgttttgccgctttacatccaatcgttctcatagtttgtttcacaatggggacatccatttgaacatagaactcctctc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45565524 |
agatcagcctcgcaccatatttgttttgccgctttacatccaatcgttctcatagtttgtttcacaatggggacatccatttgaacatggaactcctctc |
45565623 |
T |
|
| Q |
254 |
tcttgaagactcataagagtaggaagaatacctccaagcacacttc |
299 |
Q |
| |
|
| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45565624 |
ttttgaagtctcataagagtaggaagaatacctccaagcacacttc |
45565669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 45565665 - 45565699
Alignment:
| Q |
1 |
acttcaaagaaaaactttgatctgttagagaattc |
35 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45565665 |
acttcaaagaaaaactttgatctgttacagaattc |
45565699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 193 - 225
Target Start/End: Complemental strand, 45286972 - 45286940
Alignment:
| Q |
193 |
ccaatcgttctcatagtttgtttcacaatgggg |
225 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
45286972 |
ccaatcgttctcgtagtttgtttcacaatgggg |
45286940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11508 times since January 2019
Visitors: 8091