View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk44-1 (Length: 238)
Name: R108-tnk44-1
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R108-tnk44-1 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 6387794 - 6388028
Alignment:
| Q |
1 |
gaaacaaagcaaaggtgcaagtaaggaagaaagcactgaaatattctagtaaatagaagacttgatgaaaacagaacccatgaaattaaatataacatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6387794 |
gaaacaaagcaaaggtgcaagtaaggaagaaagcactgaaatattctagtaaatagaagaattgatgaaaacagaacc-atgaaattaaatataacatgc |
6387892 |
T |
|
| Q |
101 |
tggcaaacccttgcaaacagagaactgactcgtctcaggcgcccataatcgcaacatgttaagaagtttgaaaccaagctcactgtcataagtagtgaag |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6387893 |
tggcaaacc-ttgcaaacagagaactgactcgtctcaggcgcc-ataatcgcaacatgttaagaagtttgaaaccaagctcactgtcataagtagtgaag |
6387990 |
T |
|
| Q |
201 |
aggagactaataggctcaagtggtgctgttgagcagat |
238 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6387991 |
aggagactaatgggctcaagtggtgctgttgagcagat |
6388028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13443 times since January 2019
Visitors: 8302