View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk48-8 (Length: 112)
Name: R108-tnk48-8
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R108-tnk48-8 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 5e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 5e-41
Query Start/End: Original strand, 24 - 112
Target Start/End: Original strand, 6631409 - 6631497
Alignment:
| Q |
24 |
aattctagaggcaagacacggcgataaggtttaaaattgaggtctgtaactgcaattctggttgtagcatacagattttaagatatttg |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6631409 |
aattcaagaggcaagacacggcgataaggtttaaaattgaggtctgtaactgcaattctggttgtagcatacagattttaagatatttg |
6631497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14283 times since January 2019
Visitors: 8378