View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk48-9-i (Length: 389)
Name: R108-tnk48-9-i
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] R108-tnk48-9-i |
| |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 24 - 288
Target Start/End: Original strand, 23149322 - 23149585
Alignment:
Q |
24 |
taaccatgatggggctctttatactattatggaaaatactccgtgcatttttcttgtgactaacaagattgaataatgggaagaataaatgtttattttt |
123 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23149322 |
taaccatgatggggctctttatactattatggaaaatactccatgcatttttcttgtgactaacaagattgaataatgggaagaataaatgtttattttt |
23149421 |
T |
|
Q |
124 |
cgacaaatatagtgtaaag-aaaaaactatgtatctccaacatcattaaaattcaagattgaataatctagaatttggactttaatttatcaaataaaaa |
222 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
T |
23149422 |
cgacaaatatagtgtaaagaaaaaaactatgtatctccaacatcattaaaattcaagattgaataatctag-atttgtactttaatttatcaaataaaaa |
23149520 |
T |
|
Q |
223 |
tctgcatttttatagaatggtttgatcaaagaccggaatgtctactaatattattgaaaatataat |
288 |
Q |
|
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23149521 |
tctgcatttttatag-attgtttgatcaaagaccggaatgtctactaatattattgaaaatataat |
23149585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 355 - 389
Target Start/End: Original strand, 23149262 - 23149296
Alignment:
Q |
355 |
gaattcgtacagatttaccaaagatatggatcaac |
389 |
Q |
|
|
||||||||| ||||||||||||||||||||||||| |
|
|
T |
23149262 |
gaattcgtatagatttaccaaagatatggatcaac |
23149296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12149 times since January 2019
Visitors: 8179