View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk507-A12 (Length: 225)
Name: R108-tnk507-A12
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R108-tnk507-A12 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 8340330 - 8340103
Alignment:
| Q |
1 |
gttgagaa-ttgtaaattggacatccaaattgcaatttgagagttatgaatacttttatttcaaatttcgatatagatgtctgtttac-acttccgccac |
98 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
8340330 |
gttgagaacttgtaaattggacatccaaattgcaatttgagagttatgaatacttttatttcaaatttcgatatggatgtctgtttacaacttccgccac |
8340231 |
T |
|
| Q |
99 |
ctctcaaattttaaaggcaaagttattttcttcacaacannnnnnnaacccctctcattaggggaagg-catttaaggttcatgttcctgatttaggtat |
197 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8340230 |
ctctcaaattttaaaggaagagttattttcttcacaacatttttttaacccctctcattgggggaaggccatttaaggttcatgttcctgatttaggtat |
8340131 |
T |
|
| Q |
198 |
taggttagatattgttttgatgcttgcc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
8340130 |
taggttagatattgttttgatgcttgcc |
8340103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 8407 times since January 2019
Visitors: 7802