View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk507-A61 (Length: 242)
Name: R108-tnk507-A61
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R108-tnk507-A61 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 56 - 242
Target Start/End: Complemental strand, 5809074 - 5808886
Alignment:
| Q |
56 |
tgctaaggatgtgcttatagtagaggcatctctaaactagtgaaagatgggatgtttgatatgatgaatgacacaagacaactgaaaataccatgtcgta |
155 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
5809074 |
tgctaaggatgtgctta--gtagaggcatctctaaactagagaaagatgggatgtttgatatgatgaatgacacaagacaactgaaaataccatgtcata |
5808977 |
T |
|
| Q |
156 |
ctttata----tatagatgatataataaatcacaaacatgtttggaatttatagtgtgttttaggaaggatatgttttgaggtaatgttat |
242 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5808976 |
ctttatatatatatagatgatataataaatcacaaacatatttggaatttagagtgtgttttaggaaggatatgttttgaggtaatgttat |
5808886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 5809060 - 5809007
Alignment:
| Q |
1 |
ttagtagaggcttctctaaactagtgtaagatgggatgtttgatacgatgaatg |
54 |
Q |
| |
|
||||||||||| |||||||||||| | |||||||||||||||||| |||||||| |
|
|
| T |
5809060 |
ttagtagaggcatctctaaactagagaaagatgggatgtttgatatgatgaatg |
5809007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 12582 times since January 2019
Visitors: 8222