View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk507-A71 (Length: 320)
Name: R108-tnk507-A71
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R108-tnk507-A71 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 1e-87; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 61 - 228
Target Start/End: Complemental strand, 25187523 - 25187356
Alignment:
| Q |
61 |
tattaatatttcttctccattaggattttctcctcgattcgtcaaaccaaacatgtatgaaatcactctcttttgcccctccattaagcttcctctacac |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25187523 |
tattaatatttcttctccattaggattttctcctcgattcgtcaaaccaaacatgtatgacatcactctcttttgcccctccattaagcttcctctacac |
25187424 |
T |
|
| Q |
161 |
aattgaaccaaacagtacctaagtgtgtgttcatggatactcttcaatttcaaagacattattactac |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25187423 |
aattgaaccaaacagtacctaagtgtgtgttcatggatactcttcaatttcaaagacattattactac |
25187356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 25187302 - 25187236
Alignment:
| Q |
1 |
ggtgattcacttgaattgaaatctatgagacattgtgaataatatgcgacaataattatgtattaat |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25187302 |
ggtgattcacttgaattgaaatctatgagacattgtgaataatatccgacaataattatgtattaat |
25187236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 257 - 320
Target Start/End: Complemental strand, 25187361 - 25187298
Alignment:
| Q |
257 |
tactactgcaatttcgaacaaaaactattgattcacttgaagtgaaatccttgtgacatggtga |
320 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25187361 |
tactactgcaatttcgaagaaaaactattgattcacttgaagtgaaatccttgtgacatggtga |
25187298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13429 times since January 2019
Visitors: 8302