View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk507-E10 (Length: 349)
Name: R108-tnk507-E10
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R108-tnk507-E10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 43551186 - 43551342
Alignment:
| Q |
1 |
atgtcaaacactaacatcttccctttgctttcattgacaatataataaggtaacaaaatttgggtgcagagaacctttttatataatgataggcagagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43551186 |
atgtcaaacactaacatcttccctttgctttcattgacaatataataaggtaacaaaatttgggttcagagaacctttttatataatgataggcagagaa |
43551285 |
T |
|
| Q |
101 |
aatcagagtaagaaatccatgtaatttgtgatattttcttcttgtcattcttgaatt |
157 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43551286 |
aatcagagtaagaaatcaatgtaatttgtgatattttcttcttgtcattcttgaatt |
43551342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 159 - 237
Target Start/End: Original strand, 43551001 - 43551077
Alignment:
| Q |
159 |
accaaatatactatatatggnttggtgccaatctcagtagtacgnggggaaattngaagcattatacaaaattacaacg |
237 |
Q |
| |
|
|||||| | ||||||||||| ||| ||||||||||||| ||||| | | ||||| |||||||||||||||||||||||| |
|
|
| T |
43551001 |
accaaacacactatatatggtttg-tgccaatctcagtggtacgtgtg-aaatttgaagcattatacaaaattacaacg |
43551077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9006 times since January 2019
Visitors: 7892