View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk507-E11 (Length: 218)
Name: R108-tnk507-E11
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R108-tnk507-E11 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 66; Significance: 2e-29; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 153 - 218
Target Start/End: Original strand, 33003577 - 33003642
Alignment:
| Q |
153 |
actttagcatttaaattcaaagtttggtacatggcattttaaaatgttgggtttcaaggtaagttt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33003577 |
actttagcatttaaattcaaagtttggtacatggcattttaaaatgttgggtttcaaggtaagttt |
33003642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 33003638 - 33003697
Alignment:
| Q |
1 |
agtttcttctaaacaccaagtgtgctataaattagtttcaaatgtcaatatcatcaattg |
60 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33003638 |
agtttcttcaaaacaccaagtgtgccataaattagtttcaaatgtcaatatcatcaattg |
33003697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 56 - 104
Target Start/End: Original strand, 33003519 - 33003567
Alignment:
| Q |
56 |
aattggtcatggcttttaaaattttgacatttaattcaatataatctca |
104 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33003519 |
aattggtcatggcttttaaaattttgatatttaattcaatataatctca |
33003567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 14662 times since January 2019
Visitors: 8422