View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk507-E55 (Length: 545)
Name: R108-tnk507-E55
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R108-tnk507-E55 |
 | |
|
| [»] scaffold0152 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0152 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: scaffold0152
Description:
Target: scaffold0152; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 342
Target Start/End: Complemental strand, 11651 - 11310
Alignment:
| Q |
1 |
atattaatacaaattgagacaatgatgaaacataaaggccattgcttctcttcatttcatcatcaatgggtccagtacaaacatataatagagaacaaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11651 |
atattaatacaaattgagacaatgatgaaacataaaggccattgcttctcttcatttcatcatcaatgggtccagtataaacatataatagagaacaaac |
11552 |
T |
|
| Q |
101 |
ttctactaattaagaaggaaatacaacttgttagacaaaacataatgaaaatactaaatgaagatagggattactaaagacat-nnnnnnnnnnnnnnnn |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11551 |
ttctactaattaagaaggaaatacaacttgttagacaaaacataatgaaaatactaaatgaagatagggattactaaagacataaaaaaacgaaaaaaac |
11452 |
T |
|
| Q |
200 |
nnnnncaacttagaaatagacaaggtcttgccaatttaaatcagtccacacttgcagagtatcgttacttcgaacaaccggtgcaccaaaccatcacatt |
299 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11451 |
caaaacaacttagaaatagacaaagtcttgccaatttaaatcagtccacacttgcagagtatcgttacttcgaacaaccggtgcacc-aaccatcacatt |
11353 |
T |
|
| Q |
300 |
agaaccttcacaaagccttctagcaagaaccattcgattgaaa |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11352 |
agaaccttcacaaagccttctagcaagaaccattcgattgaaa |
11310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 412 - 474
Target Start/End: Original strand, 18418111 - 18418175
Alignment:
| Q |
412 |
ctctggataatagacaactggttctgag-aataaaacnaccnggatg-aaccnagagacncaaaa |
474 |
Q |
| |
|
|||| |||||||||||| |||||||||| |||||||| ||| ||||| |||| |||||| ||||| |
|
|
| T |
18418111 |
ctcttgataatagacaattggttctgagaaataaaacaaccaggatgaaaccaagagacacaaaa |
18418175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13540 times since January 2019
Visitors: 8302