View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk507-E89 (Length: 202)
Name: R108-tnk507-E89
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R108-tnk507-E89 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 2e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 11493037 - 11493183
Alignment:
| Q |
1 |
gttactacggtttttcggaaggtacacaaataggatacatgcatcgctaatgaagtaaagttaatggccacgtttcctttgagtttgggaaaatatttca |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11493037 |
gttactacggtttttcggatggtacacaaataggatacatgcatcgctaatgaagtaaagttaatggccacgtttcctttgagtttgggaaaatatttca |
11493136 |
T |
|
| Q |
101 |
gggagggaaatatattgaatgaagaacaactaattcgaaagaattca |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11493137 |
gggagggaaatatattgaatgaagaacaactaattcgaaagaattca |
11493183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 141 - 202
Target Start/End: Original strand, 11492980 - 11493041
Alignment:
| Q |
141 |
gaattcatatataggattagaggcaaataaaacagtctacattctatattactagaagttac |
202 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11492980 |
gaattcatatataggagtagaggcaaataaaacagtctacattctaaattactagaagttac |
11493041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 10153 times since January 2019
Visitors: 7975