View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk52-1 (Length: 150)
Name: R108-tnk52-1
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] R108-tnk52-1 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 6e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 6e-57
Query Start/End: Original strand, 24 - 150
Target Start/End: Complemental strand, 41740092 - 41739965
Alignment:
| Q |
24 |
ggagattcatggacttcttattgttgtcaatttagaggg-ttgtcgatttttgttatctgctgaataattgatatttctagtatggttagttgctgctac |
122 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41740092 |
ggagattcatagacttcttattgttgtcaatttagaggggttgtcgatttttgttatctgctgaataattgatatttctagtatggttagttgctgctaa |
41739993 |
T |
|
| Q |
123 |
tttcaataatcatatgcctgtttaggat |
150 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41739992 |
tttcaataatcatatgcctgtttaggat |
41739965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15727 times since January 2019
Visitors: 3757